Name: Methylated cytosine DNA standard kit
Brand: GeneTex
SKU: GTX400004
Price: 299.00 USD

Methylated cytosine DNA standard kit

Cat. No. GTX400004

GTX400004 Dot Image

GeneTex methylated cytosine DNA standard kit includes five recombinant double-strand DNA fragments: unmethylated cytosine DNA (C), 5-methylated cytosine DNA (5mC), 5-hydroxymethycytosine cytosine DNA (5hmC), 5-formylcytosine cytosine DNA (5fC), 5-carboxylcytosine cytosine DNA (5caC). Each methylated cytosine DNA was spotted onto a positively charged nylon membrane and subjected to Dot blot assay with corresponding antibodies.
The membrane was incubated with anti-5hmc monoclonal antibody (GTX629701) at a dilution of 1:500 or with anti-5mc monoclonal antibody (GTX629448) at a dilution of 1:500

1 / 2

GTX400004 Dot Image

All five standards are 426 bp with all cytosines either unmodified (lane 1, C), 5-methylcytosine (lane 2, 5mC), 5-hydroxymethylcytosine (lane 3, 5hmC), 5-formylcytosin (lane4, 5fC), 5-carboxycytosine (lane5, 5-caC). DNA marker: 1 kb Plus DNA marker.

2 / 2

Applications

Dot

Summary

The Methylated cytosine DNA standard kit is a set of five DNA standards that are linear dsDNA, 426 bp, and have the same sequence (see sequence below & figure). The only difference is that each contains either normal cytosines, 5-methylcytosines, 5-hydroxymethylcytosines, 5-formylcytosines, or 5-carboxylcytosines. Since the sequence and extent of cytosine modification is known, this DNA standard set is ideal for use in calibration of various applications intended for quantitation of cytosine modifications.
Sequence Information:
5'CGGGGTACCTTCACTTCAGAATCAACCAAACAGCCAAAACTGTTACATCAGGTTGTGGA GCAGTTACAAAAGGTTCATTTTATCACAGATACCCTGTCAAAGGGTGAGACAAAGTTCATG GGTGTTTGCCAGCTTCCCAGTAAAAATGATGAAAAAGAATATCCACACAGAAGAATTGATA TCAGGTTGATACCCAAAGATCAGTATTACTGTGGTGTTCTCTATTTCACTGGGAGTGATAT TTTCAATAAGAATATGAGGGCTCATGCCCTAGAAAAGGGTTTCACAATCAATGAGTACACC ATCCGTCCCTTGGGAGTCACTGGAGTTGCAGGAGAACCCCTGCCAGTGGATAGTGAAAAA GACATCTTTGATTACATCCAGTGGAAATACCGGGAACCCAAGGACCGGAGCGAAGAATTC CCG 3'
Note: Sequence is same for all five standards. Depending on the DNA, all C’s are unmodified cytosine, 5-methylcytosine, 5-hydroxymethylcytosine, 5-formylcytosine, or 5-carboxylcytosine.

Sequence statistics:

Nucleotide	Count	Frequency (%)
Adenine (A)	138	32.4 %
Thymine (T)	103	24.2 %
Cytosine (C)	88	20.7 %
Guanine (G)	97	22.8 %
C+G	185	43.4 %
A+T	241	56.6 %

Content

Content	Package	Storage
Cytosine DNA Standard	2 μg	4ºC or below
5-Methylcytosine DNA Standard	2 μg	4ºC or below
5-Hydroxymethylcytosine DNA Standard	2 μg	4ºC or below
5-Formylcytosine DNA Standard	2 μg	4ºC or below
5-Carboxylcytosine DNA Standard	2 μg	4ºC or below